SCARNA12

SCARNA12 Gene - GeneCards | SCARNA12 RNA Gene

SCARNA12 (Small Cajal Body-Specific RNA 12) is an RNA Gene, and is affiliated with the snoRNA class. Diseases associated with SCARNA12 include Tibial ...

scarna12

677777 - Gene ResultSCARNA12 small Cajal body-specific RNA 12 ...

SCARNA12 small Cajal body-specific RNA 12 [ (human)]. Gene ID: 677777, updated on 21-Dec-2019. Summary. This gene produces a small nuclear RNA that ...

scarna12

OMIM Entry - SMALL CAJAL BODY-SPECIFIC RNA 12; SCARNA12

Small nucleolar RNAs (snoRNAs), like SCARNA12, act as guides to direct posttranscriptional modification of RNAs. SnoRNAs containing a C/D box associate ...

scarna12

SCARNA12 - GEO Profiles Result

SCARNA12 - MicroRNA-135b overexpression effect on prostate cancer cell line: time course Annotation: SCARNA12, small Cajal body-specific RNA 12 ...

scarna12

Gene: SCARNA12 (ENSG00000238795) - Summary - Homo ...

small Cajal body-specific RNA 12 [Source:HGNC Symbol;Acc:HGNC:32569]. Gene Synonyms. U89. Location. Chromosome 12: 6,967,337-6,967,606 reverse  ...

scarna12

SCARNA12 (small Cajal body-specific RNA 12)

SCARNA12 (small Cajal body-specific RNA 12), Authors: Dessen P. Published in : Atlas Genet Cytogenet Oncol Haematol.

scarna12

Gene: SCARNA12 (ENSG00000238795) - Summary - Homo ...

There is no ungapped mapping of this gene onto the GRCh37 assembly. View this locus in the GRCh37 archive: ENSG00000267818. Gene type. SnoRNA.

scarna12

Homo sapiens (human) small Cajal body-specific RNA 12 ...

Homo sapiens (human) small Cajal body-specific RNA 12 (SCARNA12) sequence is a product of SCARNA12, NONHSAG010353.2, lnc-PHB2-1 genes.

scarna12

File:4rfam scaRNA12 U89 stk.svg - Wikimedia Commons

29 Jun 2011 ... File:4rfam scaRNA12 U89 stk.svg. Size of this PNG preview of this SVG file: 319 × 598 pixels. Other resolutions: 128 × 240 pixels | 256 × 480 ...

scarna12

SCARNA12 - small Cajal body-specific RNA 12 - WikiGenes

The world's first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.

scarna12

ExoCarta: Gene summary

Gene description for SCARNA12. Gene name, small Cajal body-specific RNA 12. Gene symbol, SCARNA12. Other names/aliases, U89. Species, Homo sapiens.

scarna12

Homo_sapiens snoRNA :SCARNA12

Homo_sapiens SCARNA12. sequence. CAGGCTGATGAGACTAAGGCGAATGCGACTCCGTGCTCTCTGGCCCTTGGCTCCTTGTT

scarna12

SCARNA12 Gene - GeneCards | SCARNA12 RNA Gene

Complete information for SCARNA12 gene (RNA gene), small Cajal body- specific RNA 12, including: function, proteins, disorders, pathways, orthologs, and ...

scarna12

U3

CLIP3, protein_coding, cerebral cortex · RISE. hsa-mir-181a-5p, miRNA, RISE. hsa-mir-196a-5p, miRNA, RISE · MIR148A, miRNA, RISE · MIR155HG, miRNA ...

scarna12

Table 2 | Common Expression Quantitative Trait Loci Shared by ...

SCARNA12 (12), 1.70E−10, HIST1H2AB (6), 2.83E−08, HIST3H2BB (1), 1.91E− 07, RPPH1 (14), 7.69E−07. HIST1H2BM (6), 1.95E−09, HIST1H3I (6), 1.01E−07  ...

scarna12

snord60

28S_4340, rRNA, Krogh N. et al. | RISE · SCARNA12, snoRNA, RISE · SCARNA7 , ncRNA, RISE · SNORA66, snoRNA, RISE · SNORA72, snoRNA, RISE.

scarna12

Separation of sub-cellular fractions

target, fold (N/C), PCR primer, PCR primer. scaRNA2, 49.4, ACGCGTGAGTGTGTGAGTGT, GCAGGAGGAGAGCTTTTCATT. scaRNA12, 76.5  ...

scarna12

Expression Data

28S_391, rRNA, Krogh N. et al. SCARNA12, snoRNA, RISE · SCARNA17, ncRNA, RISE · SCARNA9, ncRNA, RISE · SNORD117, snoRNA, RISE · SNORD31 ...

scarna12

ING4[gene] - ClinVar Result

Name: NC_000012.12:g.(1_3750000)_(5250000_9000000)del5250000 Gene(s ): APOBEC1, C1R, C1S, C3AR1, CACNA1C, CCND2, CD4, CD9, CD27, CHD4, ...

scarna12

Expression Data

RNA5S10, RNU5F-1, SCARNA8, SCARNA12, SCARNA13, SCARNA17, SNORA7A, U5_U41. Biotype. ncRNA, rRNA, snoRNA, snRNA. Tissue Enrichment.

scarna12

Animal snoRNAs and scaRNAs with exceptional structures ...

U89 (SCARNA12). SCARNA12 is composed of an H/ACA box domain and a C/D box domain and has been shown to localize to the Cajal bodies. It is predicted ...

scarna12

Sort Ascending

Sort order: location(ASC). chromosome Sort Descending · Sort Ascending, | start Sort Descending · Sort Ascending, | end Sort Descending · Sort Ascending ...

scarna12

Printer-friendly version

HUGO Gene Nomenclature Committee. HGNC Approved Symbol, HGNC Approved Name. SCARNA12, small Cajal body-specific RNA 12 ...

scarna12

PNPT1 Release from Mitochondria during Apoptosis Triggers Decay ...

Forward primer. Reverse primer. 7SL. ATC GGG TGT CCG CAC TAA GTT. CAG CAC GGG AGT TTT GAC CT. GAPDH. AAG GTG AAG GTC GGA GTC AAC.

scarna12

scarna12

Summary of 11 significant loci for FAs and FA ratios with dietary ...

13 Apr 2019 ... 10, 12, 294, 6980, 332, MIR200C, EMG1, C1S, LPCAT3, SCARNA12, PHB2, PTPN6, MIR141, Yes, Yes, 5.5 x 10−43, rs73264687, OA.

scarna12

Table S2.

75, SCARNA12, -5.21789, ScriptSeq library. 76, SCARNA17, -4.98418, ScriptSeq library. 77, SCARNA2, -9.32703, ScriptSeq library. 78, SCARNA21, - 11.59654 ...

scarna12

RBP5 related genes - GeneCards Search Results

14, EMG1, EMG1 N1-Specific Pseudouridine Methyltransferase, Protein Coding, 41, GC12P006970, 3.53. 15, SCARNA12, Small Cajal Body-Specific RNA 12 ...

scarna12

9A8D>8I=8T 9?>;$BB ;U89? =; 9?

Explore Further: Topics Discussed in This Paper. SCARNA12 gene. Related Papers. The Allen Institute for AI. Blog posts, news articles and tweet counts and IDs ...

scarna12

Download

35, SCARNA12. 36, DUSP1. 37, TTC6. 38, MLLT4. 39, SECISBP2L. 40, SERINC3. 41, NEDD4L. 42, MAPRE1. 43, HBP1. 44, KIF5B. 45, DHX32. 46, GRHL2.

scarna12

Top 40 Candidates

12, R-187992-00, N-187992-02, SCARNA12, 677777, 91982758, NR_003010, 0.0554, -4.17. 13, R-185541-00, N-185541-06, CXorf28, 100129464 ...

scarna12

Development and validation of a skin fibroblast biomarker profile for ...

14 Dec 2019 ... SCARNA12 small Cajal body-specific RNA 12. -0.722. 0.0042. AGAP11 ankyrin repeat and GTPase domain Arf GTPase activating protein ...

scarna12

PHB2 | Homo sapiens gene | Alliance of Genome Resources

... 6.9680M 6.9685M 6.9690M 6.9695M 6.9700M 6.9705M NM_001144831 ( PHB2) NM_001267700 (PHB2) XR_242980 (PHB2) NR_003010 (SCARNA12) ...

scarna12

GMPS

... RECQL RIMKLB RPL13AP20 RPL13P5 SCARNA10 SCARNA11 SCARNA12 SCNN1A SKP1P2 SLC15A5 SLC2A14 SLC2A3 SLC6A12 SLC6A13 SLCO1A2 ...

scarna12

ExSNP - the database of expression associated SNPs

Genome browse of eQTLs for the specific SNP or Gene: 1. Browse all exGene by alphabetical order: A B C D E F G H I J K L M N O P Q R S T U V W X Y Z ...

scarna12

1. Introduction

... HIST1H3B (6) 1.13 E− 08 HIST1H2AJ (6) 1.86 E− 07 HIST1H2AH (6) 6.84 E− 07 SCARNA12 (12) 1.70 E− 10 HIST1H2AB (6) 2.83 E− 08 HIST3H2BB (1) 1.91  ...

scarna12

Gene Set - NCI-H2171

RBP5, retinol binding protein 5, cellular, 2.76305. SCARNA12, small Cajal body- specific RNA 12, 2.76305. C12ORF57, chromosome 12 open reading frame 57 ...

scarna12

Search: author:"Bateman A"

Homo sapiens (human) small Cajal body-specific RNA 12 (SCARNA12). URS000014FF3E_9606. 270 nucleotides; reference genome; Obsolete ...

scarna12

cytoband 1q41 10q11.21 12p12.3 17q11.2 21q22.2 Xq23 Xp11.22 q ...

... C1R ITGB2 TMEM78 SCARNA12 LSS SNORA51|ENSG00000206878.1 DSTNP2 MX1 RNA5SP18 RPL13P5 MX2 RNA5S17 RN7SL380P PCNT RNA5S16 ...

scarna12

963

... FAM166A TMEM145 TSPAN19 FOXD4 SPON2 C9orf173 RAB26 RGS11 SCARNA12 BOP1 ODF3L2 SLC25A2 ACCN3 SLC22A10 GABRD OR2T8 CYorf15B ...

scarna12

Comments



Warning: file(keys/10.txt): failed to open stream: No such file or directory in /home/admin/web/vmi320931.contaboserver.net/public_html/theme/footer.php on line 50

Warning: shuffle() expects parameter 1 to be array, boolean given in /home/admin/web/vmi320931.contaboserver.net/public_html/theme/footer.php on line 51

Warning: Invalid argument supplied for foreach() in /home/admin/web/vmi320931.contaboserver.net/public_html/theme/footer.php on line 54


Subscribe monelindevic.tk